snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus SNORD48
sequence
GGTGAAGATAACTTTAGGTGGCTCTGAGTGTCTCACTGACACCATCACTGCAGCATGCT
GACC
  Box motif
  Complementary to target RNA
length 63
organism Oryctolagus_cuniculus
snoRNA name SNORD48
alias
chromosome ⁄ contig GeneScaffold_2805
locus ⁄ host gene Mono:230:SNORD48
organization Mono
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved