snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus SNORA41
sequence
TTCTACAACTATTGATTGGTCTGCAGCTCTTCTTAGTAATTGTGGCATTCCACTGTGGG
AAAGAAACTGTTACACAATTGAACACTTCTTAGCAAAACAGAAAGTAGGCATATGTGTGA
AGTATAGAA
  Box motif
  Complementary to target RNA
length 128
organism Oryctolagus_cuniculus
snoRNA name SNORA41
alias
chromosome ⁄ contig GeneScaffold_3036
locus ⁄ host gene Mono:215:SNORA41
organization Mono
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved