snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus snoZ7
sequence
CAAATTTTGCTTAATGCTAAACTATGGAATTACTGTGTTATTTAAACAAATTG
  Box motif
  Complementary to target RNA
length 53
organism Oryctolagus_cuniculus
snoRNA name snoZ7
alias
chromosome ⁄ contig GeneScaffold_1073
locus ⁄ host gene Mono:238:snoZ7
organization Mono
target RNA
modification type unknown
modification site
accession no
orthologs
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved