snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus snoU2-30
sequence
GAGCAATGATGAAAAGGTTTTACAACTGACCTTTATAACTATGAGGTTTTCTACACTTG
ACCTGAGCTCA
  Box motif
  Complementary to target RNA
length 70
organism Oryctolagus_cuniculus
snoRNA name snoU2-30
alias
chromosome ⁄ contig scaffold_165032
locus ⁄ host gene Poly:24:snoU2-30
organization Poly
target RNA
modification type unknown
modification site
accession no
orthologs
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved