snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus SNORD18
sequence
CAGCCGTGATGAGATCCCAGCTCATTGGTCCGTGTTTCTGAACACGTGATGTTCTCGAC
GCTCTGATGCT
  Box motif
  Complementary to target RNA
length 70
organism Oryctolagus_cuniculus
snoRNA name SNORD18
alias
chromosome ⁄ contig scaffold_203434
locus ⁄ host gene Poly:2:SNORD16
organization Poly
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved