snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus SNORA5
sequence
TGCAGTCAAGTCAAATTCAGCCCCGGCCTGTGGTGGTGTGGGCTGGCCAGGTGGCTGCC
ACAGCGAGCTCTGCAGTTCATGGGCCCCAGGTCCCCCACTCTGGGGCCTGGGGATAAGTT
TGGCTGCGGACAGGG
  Box motif
  Complementary to target RNA
length 134
organism Oryctolagus_cuniculus
snoRNA name SNORA5
alias
chromosome ⁄ contig scaffold_176961
locus ⁄ host gene Poly:10:SNORA5
organization Poly
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved