snOPY snoRNA Orthological Gene Database
Ornithorhynchus_anatinus snoR53
sequence
TGAATTGATGATTACACTCCATGCTAAGGACAAACAGTTCAAAAATACAAATGATATGG
ATGTTCACCTTTACCACA
  Box motif
  Complementary to target RNA
length 77
organism Ornithorhynchus_anatinus
snoRNA name snoR53
alias
chromosome ⁄ contig X5
locus ⁄ host gene Mono:snoR53
organization Mono
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved