snOPY snoRNA Orthological Gene Database
Ornithorhynchus_anatinus SNORA72
sequence
CTGCGAATATTCTCGCTGGCCTGATATGCCCGTGATCAGGTCAGGCTAGACATTCGCTA
TATTGAGACCCAGCATTGTGTCCCCGGGATTAGTCCTTGCCCTAATCCTGGTTTTGCAAA
TGCTGGTGACAAAT
  Box motif
  Complementary to target RNA
length 133
organism Ornithorhynchus_anatinus
snoRNA name SNORA72
alias
chromosome ⁄ contig Ultra753
locus ⁄ host gene RPL30
organization Intronic
target RNA 5.8S rRNA
modification type H/ACA
modification site 5.8S:U54
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved