snOPY snoRNA Orthological Gene Database
Ornithorhynchus_anatinus SNORA68
sequence
ACTGCACCCCCAAGCCCCAAAGATCATTGTTTCCTTCTTCACAATGATCTTATCTGGGG
TGCTGACATCAATTGTACCTCGTCGCCTTTCAAGAGCTGTTCGAAGTGCTCCTGAAAGTG
AAATGGAAGGTTCAACATAT
  Box motif
  Complementary to target RNA
length 139
organism Ornithorhynchus_anatinus
snoRNA name SNORA68
alias
chromosome ⁄ contig Ultra659
locus ⁄ host gene RPL18A
organization Intronic
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved