snOPY snoRNA Orthological Gene Database
Ornithorhynchus_anatinus SNORD12
sequence
ATCAGTGTATGGGATGACAAAACTTTTTTCCCCATCAGATTGACGTTGAGGCCTTCCCA
GAC
  Box motif
  Complementary to target RNA
length 62
organism Ornithorhynchus_anatinus
snoRNA name SNORD12
alias
chromosome ⁄ contig Ultra56
locus ⁄ host gene Mono:SNORD12
organization Mono
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved