snOPY snoRNA Orthological Gene Database
Ornithorhynchus_anatinus SNORA69
sequence
AAAGCAGGTTGCAATTACAGTGCTTCATTCTGTGGGAGTACTGCCATTACCCTGCTGAG
AGTAAAGCTGTGTTAAATATTGCTTTGGTCTTCACATTCATAGAGGTGAAGCCCTCCAGT
TTAACATGTACACAT
  Box motif
  Complementary to target RNA
length 134
organism Ornithorhynchus_anatinus
snoRNA name SNORA69
alias
chromosome ⁄ contig Ultra390
locus ⁄ host gene Mono:SNORA69
organization Mono
target RNA 5.8S rRNA
modification type H/ACA
modification site 18S:U33,5.8S:U68
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved