snOPY snoRNA Orthological Gene Database
Ornithorhynchus_anatinus snoZ40
sequence
AAATGTTATGATGATTGGCCAAATGTTCAACTGCTCTGAAGAGAGTGAATGAAAACAGC
CTTTCTGAACATCC
  Box motif
  Complementary to target RNA
length 73
organism Ornithorhynchus_anatinus
snoRNA name snoZ40
alias
chromosome ⁄ contig Ultra29
locus ⁄ host gene Poly:SNORA40
organization Poly
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved