snOPY snoRNA Orthological Gene Database
Ornithorhynchus_anatinus SNORA13
sequence
TGCCTTGGTGTTGCCCATTCATTTGTGACGGTGATGATTTGGGTGTCAAGAGAGGCATA
AATTAGGTGCTCTGCAGCGTGTTTGATTTTAGGAGTTACTTCCTTTCTTCTTTCGCTGCT
CTGAGGGACATTG
  Box motif
  Complementary to target RNA
length 132
organism Ornithorhynchus_anatinus
snoRNA name SNORA13
alias
chromosome ⁄ contig Contig5838
locus ⁄ host gene Mono:SNORA13
organization Mono
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved