snOPY snoRNA Orthological Gene Database
Ornithorhynchus_anatinus SCARNA7
sequence
AGGTTTAGTCGTAAAATTAAGTTTTAGTATTAGTGTAAATTTTAATGGTTTGATTTTGT
ACGACTGGATATAAGGCTACGGTCAGGGGGCACTGACTCAGTAGTGTTGATTTTGGAGTG
CATCTGAGGCTGTTGCTCAAATACGTGGGCCTCATTAGCAACATTGCCAGTGATTATAGC
CCCAAAATAGCTCACCCGACTAGCTTAGCACCCAAAAATCTCTAACGGTTTCATCGATGT
GGACCTGTGATCTGA
  Box motif
  Complementary to target RNA
length 254
organism Ornithorhynchus_anatinus
snoRNA name SCARNA7
alias
chromosome ⁄ contig Contig5795
locus ⁄ host gene ENSOANG00000006965
organization Intronic
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved