snOPY snoRNA Orthological Gene Database
Ornithorhynchus_anatinus snopsi28S-3327
sequence
ATTTGGCTTTTATCAAACCCCAAATGTTTTAAAAATAATTTAAGAGGGGCTCAGTGAAA
GCCCAATGCAACCAGGTTCAGCTGTCTCTGATCTGTCCATTAAAAGCTGCAATTCTGTAA
TAATTATACCTGCATTGAA
  Box motif
  Complementary to target RNA
length 138
organism Ornithorhynchus_anatinus
snoRNA name snopsi28S-3327
alias
chromosome ⁄ contig Contig5216
locus ⁄ host gene Mono:snopsi28S-3327
organization Mono
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved