snOPY snoRNA Orthological Gene Database
Ornithorhynchus_anatinus SCARNA8
sequence
TGGGAGACTGATACACAGATAGGGCTGAAGTACTGCTCTAAATGTCACAATGCCTCCCT
AGAATAAAACTGCCTTTTGATGACCGGAACGAATTGAGTGAAATCGTAACGGACAGATAC
GGGGCAGATAACT
  Box motif
  Complementary to target RNA
length 132
organism Ornithorhynchus_anatinus
snoRNA name SCARNA8
alias
chromosome ⁄ contig Contig42585
locus ⁄ host gene Mono:SCARNA8
organization Mono
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved