snOPY snoRNA Orthological Gene Database
Ornithorhynchus_anatinus SNORD47
sequence
AACCAATGATGATAAGATTCTGCCAAATGAAAGAGACTGATTTCACCTATAAAACGTTC
CTTTTTTTATTCTGAGGTT
  Box motif
  Complementary to target RNA
length 78
organism Ornithorhynchus_anatinus
snoRNA name SNORD47
alias
chromosome ⁄ contig Contig37762
locus ⁄ host gene Poly:SNORD79
organization Poly
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved