snOPY snoRNA Orthological Gene Database
Ornithorhynchus_anatinus snosnR60_Z15
sequence
CCGATACAATGATGATAACATAGTTCAGCAGATGAAAAGTGATGAACTCTCATTTTTGT
CTTTCGCTCCTATCTGATGTATCTG
  Box motif
  Complementary to target RNA
length 84
organism Ornithorhynchus_anatinus
snoRNA name snosnR60_Z15
alias
chromosome ⁄ contig Contig37762
locus ⁄ host gene Poly:SNORD79
organization Poly
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved