snOPY snoRNA Orthological Gene Database
Ornithorhynchus_anatinus SNORD83
sequence
GCCACATGATGAACCCTGAGACGTCACTAGCATACCGTGCAAAGATGACTCACATCTAT
CACCCAAGACTGATGGTT
  Box motif
  Complementary to target RNA
length 77
organism Ornithorhynchus_anatinus
snoRNA name SNORD83
alias
chromosome ⁄ contig Contig36853
locus ⁄ host gene ENSOANG00000022295
organization Intronic
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved