snOPY snoRNA Orthological Gene Database
Ornithorhynchus_anatinus SNORD20
sequence
TGGATATGATGACTGATTATCTGAGACAAACTGATGAAACCAATAAAAATTCCTCTAGA
TAGTCAAGTTCTGATCCAC
  Box motif
  Complementary to target RNA
length 78
organism Ornithorhynchus_anatinus
snoRNA name SNORD20
alias
chromosome ⁄ contig Contig30838
locus ⁄ host gene NCL
organization Intronic
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved