snOPY snoRNA Orthological Gene Database
Ornithorhynchus_anatinus SNORA5
sequence
CGCAGCCCCGTCAAATTCGGCGCCCGCCCCCTCCGTGGCCGGCGCCGGCCCCAACGGCT
GCCACAGCAACGCCGCGGCCCATGGCCCCGCGACCCGCTCCCCGGGGCCCGGGGATAAAT
ATCGCCGCCGACACAA
  Box motif
  Complementary to target RNA
length 135
organism Ornithorhynchus_anatinus
snoRNA name SNORA5
alias
chromosome ⁄ contig Contig27359
locus ⁄ host gene ENSOANG00000015366
organization Intronic
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved