snOPY snoRNA Orthological Gene Database
Ornithorhynchus_anatinus SNORA67
sequence
GGCCAAGGAGATTCCCTCTCCCGGGGGCCGCGCCGTGCCCCTTCTGGAACGTAGCTCCT
TGGTAGAGCAGCGAGCGGGCTCATGGGGGAAAGGGCCTGATGTCGCCCCTCCCCGTCATT
CACGCCCCCACATGC
  Box motif
  Complementary to target RNA
length 134
organism Ornithorhynchus_anatinus
snoRNA name SNORA67
alias
chromosome ⁄ contig Contig26401
locus ⁄ host gene ENSOANG00000004333
organization Intronic
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved