snOPY snoRNA Orthological Gene Database
Ornithorhynchus_anatinus SNORA81
sequence
ATGCACCTCATCTAAAAAGACTTGGGTGGACCTCTTTCTTAATGTCCAGTGTCCTGTGT
CTGATGATCAGGTGCA
  Box motif
  Complementary to target RNA
length 75
organism Ornithorhynchus_anatinus
snoRNA name SNORA81
alias
chromosome ⁄ contig Contig25762
locus ⁄ host gene Mono:SNORA81
organization Mono
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved