snOPY snoRNA Orthological Gene Database
Ornithorhynchus_anatinus SNORD88
sequence
GGGTTTCCATGATGTCTTGCACTGGGCTCTGATCTCTGAGGACAACGGTGCACCCCAGG
ACTTTGACCCTCGGGGAGTCTGAGGATGCC
  Box motif
  Complementary to target RNA
length 89
organism Ornithorhynchus_anatinus
snoRNA name SNORD88
alias
chromosome ⁄ contig Contig23258
locus ⁄ host gene Mono:SNORD88
organization Mono
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved