snOPY snoRNA Orthological Gene Database
Ornithorhynchus_anatinus SNORD31
sequence
AATATTCTGTGATGAATCTATACCGCCCCAGTCTGATCATTGTGACTGAAAGGTAATTC
TGAGCTGTC
  Box motif
  Complementary to target RNA
length 68
organism Ornithorhynchus_anatinus
snoRNA name SNORD31
alias
chromosome ⁄ contig Contig18615
locus ⁄ host gene ENSOANG00000021427
organization Intronic
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved