snOPY snoRNA Orthological Gene Database
Ornithorhynchus_anatinus SCARNA17
sequence
TTGGCAGGGCAGTTGATCGACCCCACATGATCCCATTATTTTCCTTATATGATCAGGCT
TCACGACAAGGGCAGCCCTTGTTCGAAGCCTGAGGTGATTCTTTTTTGAGAGCTGGCGAT
GGGGCTTAGGGTTCAGCGT
  Box motif
  Complementary to target RNA
length 138
organism Ornithorhynchus_anatinus
snoRNA name SCARNA17
alias
chromosome ⁄ contig Contig1779
locus ⁄ host gene Mono:SCARNA17
organization Mono
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved