snOPY snoRNA Orthological Gene Database
Ornithorhynchus_anatinus SNORD34
sequence
AAGGGCCGATGATGCTGTTCAATTACCTACATTGTTTGATTTTCCTGTGAGAAAACAGC
TATATCTGAGGCCCCT
  Box motif
  Complementary to target RNA
length 75
organism Ornithorhynchus_anatinus
snoRNA name SNORD34
alias
chromosome ⁄ contig Contig153541
locus ⁄ host gene Poly:SNORD33
organization Poly
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved