snOPY snoRNA Orthological Gene Database
Ornithorhynchus_anatinus ACA59
sequence
GCCCATGGTCTTTCCACTAGGCCATGCTGCTTCCCATTTATCCATTGTGTGACCCTGGG
CAATTCACTTTATCTCTCTATGCCTCAGTTTCCTCATCTGTAAAATGGGGATCAAATTCA
GCA
  Box motif
  Complementary to target RNA
length 122
organism Ornithorhynchus_anatinus
snoRNA name ACA59
alias
chromosome ⁄ contig Contig12191
locus ⁄ host gene Mono:ACA59
organization Mono
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved