snOPY snoRNA Orthological Gene Database
Ornithorhynchus_anatinus SNORA23
sequence
GCAGCAATGTGTGCATAGTTGTCATCTGTGTCTGGTAGCTAGTCTGTTTGCGTTTTGCA
TCCAGACTTTGCTATCCACACGTACCCTGCGGCCAAAGATGAACCTGGGATCATAGTACT
GGTCTAGTGAAGTCTTTGGGACAAATCTTGCACTGGCCAGCCTCCAAACTCCCAGACATT
C
  Box motif
  Complementary to target RNA
length 180
organism Ornithorhynchus_anatinus
snoRNA name SNORA23
alias
chromosome ⁄ contig 3
locus ⁄ host gene ENSOANG00000005852
organization Intronic
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved