snOPY snoRNA Orthological Gene Database
Ornithorhynchus_anatinus SNORD36
sequence
TAAAAGTGGTGTATGAATTTCTTCACCAGAAATAACTGTGGTGATCAAACACATTAGAT
TTTTTTAACCTGAGCTAC
  Box motif
  Complementary to target RNA
length 77
organism Ornithorhynchus_anatinus
snoRNA name SNORD36
alias
chromosome ⁄ contig 1
locus ⁄ host gene Mono:SNORD36
organization Mono
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved