snOPY snoRNA Orthological Gene Database
Ornithorhynchus_anatinus SNORA7
sequence
CCCCTCTCAGGATGGCCCCTGGAGAGTTTCCGGTACTGTACCAGTCTCGACTGTGGGAG
GGCAAATCGAGCAGAGGCCTACCCAGCGTGGCCCAGTGGAAAGAACCCGGGCTTGGGAGT
CCGAGATCAGGGGTTCGGATCCCGGCTCTGCCACTTGT
  Box motif
  Complementary to target RNA
length 157
organism Ornithorhynchus_anatinus
snoRNA name SNORA7
alias
chromosome ⁄ contig Ultra4
locus ⁄ host gene DACH2
organization Intronic
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved