snOPY snoRNA Orthological Gene Database
Ornithorhynchus_anatinus SNORA49
sequence
CTTCCTCAGCCTTACTCCAGGGGCTTTCTTGCTCATAGAGTGCCCTGGCATTGCCTGAG
GATAAATCAAAAAGCCCATATCCCTCCCCAGTAGGAGCCTGATTTTCCTTTGGGGCCTAC
AGTTTGGGCTGACACA
  Box motif
  Complementary to target RNA
length 135
organism Ornithorhynchus_anatinus
snoRNA name SNORA49
alias
chromosome ⁄ contig Ultra258
locus ⁄ host gene ENSOANG00000006596
organization Intronic
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved