snOPY snoRNA Orthological Gene Database
Ornithorhynchus_anatinus SNORA51
sequence
CCCCTCCTCTCGCTTACCGCAGGCAGCAGCGGCCGTGCTGACTGTACAGAAAGAGGAGG
GAGAGCAGGCGCCCCTGAATACACCCCAGTGGTGGAGTCTGTGCCCCGACTGGACTGTGA
TCAGGGGGACAAGT
  Box motif
  Complementary to target RNA
length 133
organism Ornithorhynchus_anatinus
snoRNA name SNORA51
alias
chromosome ⁄ contig Contig17567
locus ⁄ host gene NOP56
organization Intronic
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved