snOPY snoRNA Orthological Gene Database
Ornithorhynchus_anatinus SNORD33
sequence
TGGGTCTGTGATGATGACTTTCACTTTATTTCGAGTCTCACGACCTTGAGATCACAGCT
CCATGCACTACCATCTGAGACCCC
  Box motif
  Complementary to target RNA
length 83
organism Ornithorhynchus_anatinus
snoRNA name SNORD33
alias
chromosome ⁄ contig Contig14108
locus ⁄ host gene ENSOANG00000022654
organization Intronic
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved