snOPY snoRNA Orthological Gene Database
Myotis_lucifugus SNORA3
sequence
cccgagactagagtcacatcttgacagctgttgtcctggtgtgctagagttctcagaga
gaatctgccggtcttggttcactggcgagtgcagtaagtgcccccggtagtgcccagatc
agaaacatag
  Box motif
  Complementary to target RNA
length 129
organism Myotis_lucifugus
snoRNA name SNORA3
alias
chromosome ⁄ contig scaffold_116
locus ⁄ host gene Mono:557:SNORA3
organization Mono
target RNA 28S rRNA
modification type H/ACA
modification site 28S:U3231
accession no AAPE02026479.1
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved