snOPY snoRNA Orthological Gene Database
Myotis_lucifugus SNORA65
sequence
cccgccactgcacctgaccacttctctgttggctggtgcattccaatggtgagctgaaa
gcaaactccagcttaggaaacagggtcattcttcatgtgggtgactctgtgccgaaagta
tgggaacaacc
  Box motif
  Complementary to target RNA
length 130
organism Myotis_lucifugus
snoRNA name SNORA65
alias
chromosome ⁄ contig scaffold_26
locus ⁄ host gene LOC102436747
organization Intronic
target RNA 28S rRNA
modification type H/ACA
modification site 28S:U3723,28S:U3777
accession no AAPE02012502.1
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved