snOPY snoRNA Orthological Gene Database
Myotis_lucifugus SNORD58
sequence
ctgcgatgatggcacctcttaggacacctttggattcaccgtgaaaacagcggttctct
gagcagc
  Box motif
  Complementary to target RNA
length 66
organism Myotis_lucifugus
snoRNA name SNORD58
alias
chromosome ⁄ contig scaffold_16
locus ⁄ host gene RPL17
organization Intronic
target RNA 28S rRNA
modification type C/D
modification site 28S:G3548
accession no AAPE02009055.1
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved