snOPY snoRNA Orthological Gene Database
Myotis_lucifugus SNORA46
sequence
ggcactatatttaaacctgtgtatgggaattctccccattctaggttacgctgtagtgc
aaaagaattcctggctcttttctgttgcacagctgacattgtgccattctgctgttgctg
gatggagttaaggaacataa
  Box motif
  Complementary to target RNA
length 139
organism Myotis_lucifugus
snoRNA name SNORA46
alias
chromosome ⁄ contig scaffold_263
locus ⁄ host gene CNOT1
organization Intronic
target RNA 18S rRNA
modification type H/ACA
modification site 18S:U650
accession no AAPE02038154.1
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved