snOPY snoRNA Orthological Gene Database
Myotis_lucifugus SNORD34
sequence
CGTGTCCGTGATGATCCACGATTACCTACATTGTTTGAACCTCATGAGAACAGCACTGG
CTGAGACACCG
  Box motif
  Complementary to target RNA
length 70
organism Myotis_lucifugus
snoRNA name SNORD34
alias
chromosome ⁄ contig scaffold_1432
locus ⁄ host gene RPL13A
organization Intronic
target RNA 28S rRNA
modification type C/D
modification site 28S:U2614
accession no AAPE02058383.1
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved