snOPY snoRNA Orthological Gene Database
Myotis_lucifugus SNORD85
sequence
actggcgaggatgacatatacttgccctcacttagaccacagttcgttgatgagagcac
ctaattgttctgagccagt
  Box motif
  Complementary to target RNA
length 78
organism Myotis_lucifugus
snoRNA name SNORD85
alias
chromosome ⁄ contig scaffold_438
locus ⁄ host gene PUM1
organization Intronic
target RNA 18S rRNA
modification type C/D
modification site 18S:G602
accession no AAPE02045899.1
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved