snOPY snoRNA Orthological Gene Database
Myotis_lucifugus SNORA49
sequence
ctccctcagccttactccaggggcctttgctgtaaggtgccctggcattgcctgggggc
acacgaaaaagcgcacatccctccccaggaaggctccgttctcctgtggggcctactgat
tgcgctgacagc
  Box motif
  Complementary to target RNA
length 131
organism Myotis_lucifugus
snoRNA name SNORA49
alias
chromosome ⁄ contig scaffold_1239
locus ⁄ host gene EP400
organization Intronic
target RNA
modification type H/ACA
modification site
accession no AAPE02057366.1
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved