snOPY snoRNA Orthological Gene Database
Myotis_lucifugus SNORA67
sequence
gacaaaggtgattccctctccaaggggcctaatagtcctcttctcaggataggggcaac
atggaataaaatctggcctgcctcaggtcttcagagaagaaggcgatgcataatttccat
tgcctttctttggctgtctacatgt
  Box motif
  Complementary to target RNA
length 144
organism Myotis_lucifugus
snoRNA name SNORA67
alias
chromosome ⁄ contig scaffold_3
locus ⁄ host gene ACADL
organization Intronic
target RNA 18S rRNA
modification type H/ACA
modification site 18S:U1449
accession no AAPE02003286.1
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved