snOPY snoRNA Orthological Gene Database
Myotis_lucifugus SNORA67
sequence
aaccaaggtgattccctctccaaggggactaatagtgcccctcttccggaaagtagcaa
cttggaatagaatctggcatgcctcaggttttcaggggaggtgatacaccatttccttgg
cctgcctttggctgcctacatgt
  Box motif
  Complementary to target RNA
length 142
organism Myotis_lucifugus
snoRNA name SNORA67
alias
chromosome ⁄ contig scaffold_690
locus ⁄ host gene EIF4A1
organization Intronic
target RNA 18S rRNA
modification type H/ACA
modification site 18S:U1449
accession no AAPE02052145.1?
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved