snOPY snoRNA Orthological Gene Database
Myotis_lucifugus SNORA7
sequence
aacctcccaggattgtgtctggagagtggctaatattctgccagcttcgtagacagcag
ggaaagcaagcctggcagaggtccccattccattccccacttgctccgtagctggtaatt
ggaagacactctgcaacactg
  Box motif
  Complementary to target RNA
length 140
organism Myotis_lucifugus
snoRNA name SNORA7
alias
chromosome ⁄ contig scaffold_143
locus ⁄ host gene NELL1
organization Intronic
target RNA
modification type H/ACA
modification site
accession no AAPE02029408.1
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved