snOPY snoRNA Orthological Gene Database
Myotis_lucifugus SNORA13
sequence
AGCCTTTGTGTTGCCCATTCACTTTTGGAAACTAGTGAATGTGGTGTCAAAAAAGGCAT
AAACTACACACTTTGCAACCCTTTCCTGCCCTTGAATTTGATGTCTTTGGTGGAGGAGCT
GTGTAAGTAACAGTT
  Box motif
  Complementary to target RNA
length 134
organism Myotis_lucifugus
snoRNA name SNORA13
alias
chromosome ⁄ contig scaffold_655
locus ⁄ host gene EME1
organization Intronic
target RNA 18S rRNA
modification type H/ACA
modification site 18S:U1252
accession no AAPE02051502.1
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved