snOPY snoRNA Orthological Gene Database
Myotis_lucifugus SNORA77
sequence
gccgacgcactgtgcccggccgcagtcccaggcggggctttcctcgtctgccacagaaa
cattccagggccctgtgaccgccctgaccagtcaagggtgctgccgctgcccggggacac
ggtt
  Box motif
  Complementary to target RNA
length 123
organism Myotis_lucifugus
snoRNA name SNORA77
alias
chromosome ⁄ contig scaffold_1214
locus ⁄ host gene MTMR10
organization Intronic
target RNA 18S rRNA
modification type H/ACA
modification site 18S:U815
accession no AAPE02057211.1
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved