snOPY snoRNA Orthological Gene Database
Myotis_lucifugus SNORA7
sequence
CACCTCGCAGGATCATGTCTGGAGAGTGGCTAATATTCTGCCAGCTTCGGAGACAGGAG
GGAAAGCAAGCCTGGCAGAGGTACCCATTACATTCCCTGCTTGCTTAGTAGCTGGTGACT
GGAAGACACTCTGCAACAATG
  Box motif
  Complementary to target RNA
length 140
organism Myotis_lucifugus
snoRNA name SNORA7
alias
chromosome ⁄ contig scaffold_300
locus ⁄ host gene Mono:452:SNORA7
organization Mono
target RNA 28S rRNA
modification type H/ACA
modification site 28S:U1671
accession no AAPE02040183.1
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved