snOPY snoRNA Orthological Gene Database
Myotis_lucifugus SNORA74
sequence
TCCAGCAGGGGTCAGCTCTCCAGACAGAATCATGCCTGTGAGGGTGTTACACTGCTGGG
AGAGGAATGCCCTATCTTCTTCCTCCAGTTGCTCCCTTCACTGTTCTGGTGACGTGTGGC
ACTGGTACAAGGCAGTACTGTGCTTCCTTGAGAGTGAGCTAAGCATCACTTTGGCTGCTT
AGTTGTAGTGTGGGAGTAGACGCA
  Box motif
  Complementary to target RNA
length 203
organism Myotis_lucifugus
snoRNA name SNORA74
alias
chromosome ⁄ contig scaffold_1179
locus ⁄ host gene Mono:185:SNORA74
organization Mono
target RNA 28S rRNA
modification type H/ACA
modification site 28S:U3073,28S:3075
accession no AAPE02057032.1
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved