snOPY snoRNA Orthological Gene Database
Myotis_lucifugus SNORA65
sequence
CCCGCCACTGCACCTGACCACTTCTCTGATGGCTGGTGCAATGCAGTGGTGGGCTGAAA
CTAAGGCCCAGTTTAAAAAACACATTGTTATTCTTCATATGGATGACTGTGCTGAACGCA
TGGGCACAACC
  Box motif
  Complementary to target RNA
length 130
organism Myotis_lucifugus
snoRNA name SNORA65
alias
chromosome ⁄ contig scaffold_242
locus ⁄ host gene Mono:242:SNORA65
organization Mono
target RNA 28S rRNA
modification type H/ACA
modification site 28S:U3723
accession no AAPE02036939.1
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved