snOPY snoRNA Orthological Gene Database
Myotis_lucifugus SNORA54
sequence
AAGCACTATTCGTGACCTGTTGGCCGTGCTGTGGCTAACGGGTTCCATTCCAGTGCTAC
AGCAGCCCCACTGCCACTACACTGACCGCCTGATGGTGGCTCTCAGTTTCAGGTCTTGGA
GACAAGC
  Box motif
  Complementary to target RNA
length 126
organism Myotis_lucifugus
snoRNA name SNORA54
alias
chromosome ⁄ contig scaffold_0
locus ⁄ host gene POLR3G
organization Intronic
target RNA 28S rRNA
modification type H/ACA
modification site 28S:U3133
accession no AAPE02000521.1
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved